Página Inicial » Disciplina » Simulado de Biologia – Questões Objetivas

Simulado de Biologia – Questões Objetivas

Biologia, ciência que estuda a vida e os organismos vivos. E também várias outras ciências especializadas como a ecologia, a bioquímica, a genética, a zoologia e a botânica. Responda e teste seus conhecimentos nesse simulado que preparamos com questões que caíram em provas de Concursos Públicos.

Questão 1

O microscópio eletrônico de varredura não pode fornecer informações sobre




Questão 2

As propriedades genéticas da população dependem da frequência gênica e são modificadas por qualquer alteração que ocorra no processo de transmissão dos genes de uma geração para outra. Vários são os agentes capazes de alterar as propriedades genéticas de uma população, dentre os quais pode-se citar:

I. Deriva ou oscilação genética
II. Migração
III. Mutação
IV. Seleção
V. Sistema de acasalamento

Assinale a alternativa CORRETA.




Questão 3

O tratamento biológico de resíduos/efluentes pode ser dividido em três etapas: tratamento primário, secundário e terciário. São operações típicas do tratamento primário. Assinale a alternativa CORRETA.




Questão 4

Há um critério básico na filogenia para a definição de um táxon. Para que um grupo de organismos seja considerado um táxon ele deve ser:




Questão 5

O fígado é considerado uma glândula mista. São funções do fígado, exceto:




Questão 6

Marque a alternativa que contém somente raízes utilizadas como alimento:




Questão 7

Das doenças sexualmente transmissíveis (DST), MARQUE a que é causada por um protozoário:




Questão 8

Todos os seres vivos têm suas informações genéticas codificadas pelas sequências de bases nitrogenadas dos ácidos nucleicos. Assinale a alternativa correta, considerando as informações abaixo:

Fita 1 → AAAGATCCCGAATCGGTCGGCGATTTATCG
Fita 2 → TTTCTAGGGCTTAGCCAGCCGCTAAATAGC




Questão 9

A determinação da idade de unidades litológicas e a reconstrução de ambientes pretéritos podem ser realizadas por meio de estudos paleontológicos. Embora a maioria dos fósseis correspondam a estruturas ósseas, insetos e outros invertebrados podem também ser encontrados, principalmente em âmbar. Acerca desse assunto, assinale a opção correta.




Questão 10

Durante o processo de replicação do DNA, a enzima primase sintetiza uma molécula de ácido nucleico que é pareada à fita-molde, à qual a DNA polimerase pode ligar o primeiro nucleotídio que fará parte da nova fita. A molécula e o ponto de ligação desse nucleotídio são




Tempo de simulado:

Comentar Simulado