Página Inicial » Disciplina » Simulado de Biologia – Questões Objetivas

Simulado de Biologia – Questões Objetivas

Biologia, ciência que estuda a vida e os organismos vivos. E também várias outras ciências especializadas como a ecologia, a bioquímica, a genética, a zoologia e a botânica. Responda e teste seus conhecimentos nesse simulado que preparamos com questões que caíram em provas de Concursos Públicos.

Questão 1

Todos os seres vivos têm suas informações genéticas codificadas pelas sequências de bases nitrogenadas dos ácidos nucleicos. Assinale a alternativa correta, considerando as informações abaixo:

Fita 1 → AAAGATCCCGAATCGGTCGGCGATTTATCG
Fita 2 → TTTCTAGGGCTTAGCCAGCCGCTAAATAGC




Questão 2

Durante o processo de replicação do DNA, a enzima primase sintetiza uma molécula de ácido nucleico que é pareada à fita-molde, à qual a DNA polimerase pode ligar o primeiro nucleotídio que fará parte da nova fita. A molécula e o ponto de ligação desse nucleotídio são




Questão 3

O tratamento biológico de resíduos/efluentes pode ser dividido em três etapas: tratamento primário, secundário e terciário. São operações típicas do tratamento primário. Assinale a alternativa CORRETA.




Questão 4

Marque a alternativa que contém somente raízes utilizadas como alimento:




Questão 5

Insetos necrófagos em todos os estágios imaturos de desenvolvimento foram coletados de um cadáver e enviados ao laboratório forense. Depois da incubação, esses insetos foram identificados como pertencentes à espécie Dermestes maculatus, que possui metamorfose completa. O estágio de desenvolvimento desses insetos mais adequado para estimativa do transcurso do tempo post mortem da vítima é o(a)




Questão 6

O sistema nervoso é dividido em sistema nervoso central, composto pelo encéfalo e pela medula espinhal, e sistema nervoso periférico, composto pelo tecido nervoso localizado fora do sistema nervoso central. A respeito da morfofisiologia do sistema nervoso, julgue os itens que se seguem.

I - O sistema nervoso, por meio dos impulsos elétricos que ocorrem entre seus neurônios, é capaz de integrar todas as partes do corpo.
II - O sistema nervoso central é o responsável pela transmissão das informações dos sentidos ao sistema nervoso periférico.
III - O sistema nervoso periférico controla a entrada e a saída de estímulos nervosos nos diversos órgãos e sistemas do organismo.
IV - No sistema nervoso periférico, estão arquivadas as memórias.

Estão certos apenas os itens




Questão 7

Recentemente, na região de um município não identificado, surgiram vários casos de dengue. Essa doença é transmitida por certos mosquitos, quando sugam o sangue humano. Uma das estratégias de prevenção à dengue é eliminar poças de água nas regiões urbanas, pois, nesse local, desenvolvem-se as larvas desses mosquitos. Com base no texto anterior, é possível concluir que o mosquito transmissor da dengue é:




Questão 8

São consideradas técnicas aplicadas na manipulação genética de plantas, EXCETO.




Questão 9
No microscópio eletrônico de varredura, devido à necessidade de interação do feixe eletrônico com a amostra, alguns elétrons são absorvidos pela amostra. Esses elétrons devem ser conduzidos para o fio terra do microscópio. Por isso, recomenda-se



Questão 10

A determinação da idade de unidades litológicas e a reconstrução de ambientes pretéritos podem ser realizadas por meio de estudos paleontológicos. Embora a maioria dos fósseis correspondam a estruturas ósseas, insetos e outros invertebrados podem também ser encontrados, principalmente em âmbar. Acerca desse assunto, assinale a opção correta.




Tempo de simulado:

Comentar Simulado